par Parmentier, Marc 
;Passage, E;Mattei, M G;Vassart, Gilbert
Référence Genomics, 11, 3, page (760-762)
Publication Publié, 1991-11
;Passage, E;Mattei, M G;Vassart, Gilbert Référence Genomics, 11, 3, page (760-762)
Publication Publié, 1991-11
Article révisé par les pairs
| Résumé : | A human genomic library was screened with a 30-base oligomer corresponding to the 5' end of the human calretinin cDNA. A clone that contains a minisatellite composed of 21 imperfect repeats of a 37-bp sequence was isolated. The consensus (GAGGGAGGAACTGGGACGCGTGCATGTTTGCATTCTC) incidentally shares 14 consecutive matches with the oligomer used as a probe, and it was shown that the clone did not belong to the calretinin locus. The minisatellite, named K29, was used as a probe on Southern blots at high stringency. After HaeIII, MboI, or HinfI digestion, it detected a single hypervariable locus, with 65% heterozygosity among Caucasian individuals. The probe used at low stringency revealed a fingerprint, with an average of four bands in addition to the locus-specific pattern. Mendelian inheritance was assessed on pedigrees. The K29 minisatellite was mapped by in situ hybridization to the very end of the long arm of chromosome 2 (2q37.3 band), at close proximity of the Fra2J locus, and is referred to as the D2S88 locus in the genome database. |
